Volumen 9 No. 4
Octubre-Diciembre 2008

Salus cum propositum vitae

IDENTIFICACIÓN MOLECULAR DE PROBIOTICOS AISLADOS DE ALIMENTOS Y SUPLEMENTOS: COMPARACIÓN CON MÉTODOS BIOQUÍMICOS

Iván Key Martínez-Barragán, Blanca Edelia González-Martínez, Eduardo Campos-Góngora, Ana Paulina Barba de la Rosa* y Zacarías Jiménez-Salas

Centro de Investigación en Nutrición y Salud Pública, Facultad de Salud Pública y Nutrición, Universidad Autónoma de Nuevo León, Monterrey N. L., México.

*Laboratorio de Proteómica y Expresión Génica, División de Biología Molecular, del Instituto Potosino de Investigación Científica y Tecnológica AC. San Luís Potosí, México. 

E-mail: zjimenez@faspyn.uanl.mx

Introducción

Las tendencias mundiales de la alimentación en los últimos años indican un interés acentuado de los consumidores hacia ciertos alimentos que, además de valor nutritivo, aporten beneficios a las funciones fisiológicas del organismo humano (1). Estas variaciones en los patrones de alimentación generaron una nueva área de desarrollo en la ciencia de los alimentos y de la nutrición que corresponde a la de los alimentos funcionales, entre los que se encuentran los alimentos con probióticos. En la actualidad, se observa una clara preocupación en nuestra sociedad por la posible relación entre el estado de salud personal y la alimentación que se recibe (2).

Los probióticos son microorganismos vivos que al ser ingeridos en cantidades adecuadas producen efectos benéficos para la salud del consumidor, adicionales a los efectos benéficos nutritivos de los alimentos (3). El efecto benéfico de los microorganismos probióticos se debe a que cuando se ingieren en las cantidades adecuadas ocurre una modificación del ecosistema de los microorganismos que habitan en el intestino, generando un equilibrio que se manifiesta por un mejor estado de salud (4). En algunos países europeos y en Japón, el consumo de probióticos es común y se han utilizado como profilácticos de enfermedades diarreicas desde hace muchos años, entre las bacterias probióticas mas utilizadas aparecen los lactobacilos y las bifidobacterias. Entre los lactobacilos mas utilizados se encuentran Lactobacillus casei subsp. casei, Lactobacillus acidophilus y Lactobacillus casei subsp. rhamnosus (5).

En los aspectos de seguridad es crucial el poder comparar aislados clínicos y cepas patentadas, así como monitorear la estabilidad genética de las cepas. Por lo anterior queda claro que la identificación de las bacterias ácido lácticas es importante en diferentes campos de la investigación alimenticia para lo cual se necesitan herramientas para monitorear el uso de cepas patentadas o para distinguir cepas probióticas de aislados naturales del tracto gastrointestinal del hospedero o de microorganismos contaminantes en los procesos de producción de los alimentos funcionales con deficiente control de calidad (6).

A fin de asegurar la inocuidad de las cepas de probióticos y la certeza de los efectos benéficos de los mismos, previamente probados en numerosas publicaciones, los expertos de la FAO y la OMS en el 2002 redactaron nuevas guías para la evaluación de probióticos en alimentos;  estas incluyen como primer punto una identificación no sólo hasta género, sino hasta conocer la cepa específica de los microorganismos presentes en los alimentos (7).

En este sentido se han desarrollado diversos métodos para la identificación de cepas probióticas que incluyen el análisis morfológicos de las colonias, el análisis bioquímicos por medio de pruebas de fermentación de carbohidratos y actualmente el análisis genético para la diferenciación de especies. Se ha descrito que algunas técnicas moleculares pueden ser de utilidad en la identificación de los microorganismos en cuestión, entre las que destacan aquellas basadas en la reacción en cadena de la polimerasa (PCR) y polimorfismos de longitud de fragmentos de restricción (RFLP) que resultan extremadamente valiosos tanto para la caracterización específica como para la detección de tales cepas (8).

El objetivo de este trabajo fue identificar mediante la técnica de PCR cepas de microorganismos probióticos de las subespecies L. casei subsp. casei y L. casei subsp. rhamnosus y de la especie L. acidophilus que previamente habían sido aisladas de alimentos y suplementos e identificadas por el método de fermentación de carbohidratos (API).

Material y Métodos

Para cumplir los objetivos se utilizó la estrategia general que se ilustra en la Figura 1.

Figura 1. Diagrama de la estrategia general empleada

 

Las cepas bacterianas a analizar fueron reactivadas en caldo MRS por 24 h a 37 oC. La identificación de los diferentes probióticos se realizó mediante la técnica de PCR amplificando regiones específicas de cada una de las especies o subespecies analizadas. Este proceso incluyó la selección de los iniciadores, la obtención del ADN de las cepas, la estandarización de la técnica de PCR y finalmente, la electroforesis en geles de agarosa de los productos de la amplificación.

Material biológico. Las bacterias ácido lácticas fueron aisladas de alimentos y suplementos con probióticos que se consumen en Monterrey N. L.(México) y que pertenecen a la colección de la Facultad de Salud Pública y Nutrición (9). El ADN de las cepas utilizadas como controles positivos de amplificación fueron obtenidas de la ATCC; L. casei subsp. casei. (393), L. casei subsp.rhamnosus (53103) y L. acidophilus (4356).

Cultivo de probióticos.  Las cepas de probióticos fueron reactivadas a partir de los cultivos almacenados a -20 oC en glicerol al 50%. Se tomaron de 50 a 100 ml de los cultivos almacenados, se inocularon tubos de ensayo con 3 ml de caldo Man-Rogosa-Sharp (MRS) a pH 6.5 y se incubaron a 37 oC por 12 a 16 horas. Se sembró por estría en una caja petri de 90 mm y se aisló una colonia bacteriana de cada uno de los cultivos y a partir de ella se hicieron los cultivos necesarios en medio MRS para la obtención de biomasa bacteriana.

Extracción del DNA genómico. Para la extracción del DNA genómico de las bacterias se utilizó el kit comercial DNAzol® (Molecular Research Center, Inc.) siguiendo las instrucciones del fabricante. Las pastillas de DNA se resuspendieron en 50 ml de agua ultrapura estéril y se almacenaron a -20 oC.

Condiciones de PCR.  Las secuencias nucleotídicas de los iniciadores utilizados para la PCR fueron diseñados basados en el gen que codifica para la subunidad 16S ribosomal: para L. acidophilus  AGGTAGTAACTGGCCTTTAT y ATTGTAGCACGTGTGTAGCC para L. casei subsp.casei GCCTCAGCGTCAGTTACAGA y GATAGCTAATACCGCATAAC y para L. casei subsp. rhamnosus CGTGGGTAACCTGCCCTTAA y CAGACAAGCCGCCTTCGGCC (de 5’ a 3’ y de 3’ a 5’, respectivamente) (10).  Cada mezcla de reacción de PCR se realizó en un volumen total de 25 microlitros. Para la amplificación se utilizaron programas específicos para cada especie y subespecie en un termociclador Mastercicler de marca Eppendorf. Las condiciones de amplificación para cada especie y subespecie se resumen en la Tabla 1.

Tabla 1. Condiciones de amplificación

Electroforesis. El ADN purificado y los productos amplificados por PCR se visualizaron en geles de agarosa al 1% y 3%, respectivamente. Se utilizó buffer TAE al como buffer de corrida y se aplicó un voltaje de 20 voltios durante 5 min y 80 voltios durante 30 min. Los geles se tiñeron con 1 microlitro de bromuro de etidio a una concentración de 10 mg/ml, por cada 20 ml de agarosa y se visualizaron con luz ultravioleta en un transiluminador.

Análisis de los productos amplificados. Los productos amplificados se analizaron en base al tamaño del segmento y se compararon con los segmentos obtenidos de los controles positivos de cada cepa.

Finalmente, los productos analizados fueron comparados con los resultados bioquímicos obtenidos previamente utilizando el sistema de identificación API (medio CHL y galerías 50 CH bioMériux I’ Etoile France) (11).

Resultados

Para estandarizar la técnica de PCR, se utilizaron como controles positivos de amplificación muestras de ADN obtenidas de cepas de referencia. Debido a que las temperaturas de desnaturalización y amplificación son constantes (94 oC y 72 oC, respectivamente), en las reacciones de PCR se probaron diferentes temperaturas de alineamiento (50 a 64oC) (Tabla 1). Se encontró que la temperatura óptima de alineamiento para L. casei  subsp. casei fue de 52 oC, obteniéndose el producto esperado de 607 pb sin la presencia de bandas inespecíficas de amplificación. Con el DNA de L. casei subsp. rhamnosus se obtuvo un producto amplificado de 634 pb con una temperatura de alineamiento de 61 oC y para L. acidophilus el producto amplificado de 779 pb se obtuvo con una temperatura de 54 oC (Ver Figura 2).

Figura 2. Productos amplificados por PCR usando como templado el DNA obtenido de los probióticos de referencia. M: marcador de pares de bases (pb), 1: control positivo amplificado de L. acidophilus, 2: control positivo amplificado de L. casei subsp. casei, 3: control positivo amplificado de L. casei subsp. rhamnosus. Electroforesis en gel de agarosa al 3%.

El ADN genómico de cada una de las cepas a probar fue sometido a PCR utilizando iniciadores específicos para cada una de las especies estudiadas. En la Figura 3 se muestra un concentrado de los resultados; el análisis permitió identificar la presencia de L. casei subsp. casei (muestras 5, 6 y 10) con fragmentos amplificados de 607 pb, L. casei subsp. rhamnosus (muestras 1, 3 y 4) con fragmentos amplificados de 634 pb y L. acidophilus (muestras 2, 7, 9, 11 y 12) con formación de fragmentos amplificados de 779 pb.

Figura 3. Electroforesis en gel de agarosa al 3% de los productos que fueron amplificados por PCR usando como templado el DNA obtenido de las muestras de bacterias ácido lácticas. M: marcador de pares de bases; 1, 3 y 4: muestras identificadas como L. casei subsp. rhamnosus, con un producto amplificado de 634 pb; 2, 7, 9, 11, y 12: cepas identificadas como L. acidophilus, con un producto amplificado de 779 pb; 5, 6 y 10: cepas identificadas como L. casei. subsp.casei, con un producto  amplificado de 607 pb. En el gel se omitió la muestra 8 debido a que no se obtuvieron productos de amplificación con ninguno de los juegos de primers probados.

En la Tabla 2 se hace una comparación entre los resultados obtenidos de la identificación de las diferentes cepas tanto por métodos bioquímicos (API) como por el procedimiento de PCR. Se observa que 7 de las 12 cepas probióticas analizadas (58.3%) coinciden en resultados. Las cepas 4, 5, 6 y 10 se identifican por PCR como especies diferentes a las reportadas con el método bioquímico. La cepa 8, que por el método bioquímico API se identifica como L. paracasei, no pudo ser identificada con la técnica molecular de PCR usando los juegos de iniciadores descritos.

Tabla 2. Comparación entre los métodos de identificación bioquímico y molecular

Discusión

Desde la última década del siglo pasado surgió un considerable incremento en el consumo de alimentos funcionales debido a que el público consumidor buscó adquirir alimentos que, además de valor nutritivo, mejoren la salud aportando beneficios a las funciones fisiológicas del organismo. Entre estos alimentos se encuentran los productos con probióticos ya que promueven beneficios como mejorar el estado nutricio y prevenir o tratar diversas enfermedades tales como disfunciones intestinales, infecciones gastrointestinales, enfermedades de base inmunológica e hipercolesterolemia, entre otras (12, 13).

Diversas investigaciones ponen de manifiesto que los beneficios propuestos por el consumo de probióticos dependen del tipo de microorganismo ingerido. No todos los lactobacilos son iguales, los efectos benéficos son específicos de cada especie (14); es decir, no todas las cepas bacterianas incorporadas a los productos alimenticios generan necesariamente efectos benéficos iguales en el hospedero por lo que se considera que las propiedades benéficas son dependientes de la cepa (15).  Lo anterior pone de manifiesto la necesidad de identificar con precisión los microorganismos utilizados como probióticos para poder asegurar sus beneficios. De esta forma, se ha vuelto de suma importancia identificar claramente a estos microorganismos con técnicas altamente confiables; las técnicas moleculares son una herramienta rápida y segura que se utiliza en la identificación de tales microorganismos.

El objetivo de este trabajo fue identificar mediante la técnica de PCR cepas de microorganismos probióticos de las subespecies L. casei subsp. casei y L. casei subsp. rhamnosus y de la especie L. acidophilus que previamente habían sido aisladas de alimentos y suplementos e identificadas por el método de fermentación de carbohidratos (API).

De las 12 cepas analizadas, solamente se pudieron identificar 11 (91.6%) por PCR ya que una de ellas (8.3%) no mostró producto amplificado con alguno de los 3 juegos de iniciadores probados.

Siete de las cepas analizadas (58.3%) coincidieron en la identificación por ambos métodos; se encontró que 2 cepas de L. casei subsp. rhamnosus (16.6%) coincidieron con la misma especie al analizarse con la técnica de PCR y el metodo bioquímico; en cambio, de las 6 cepas de L. acidophilus solo 5 (41.6%) coincidieron y una fue identificada como L. casei subsp. casei  y de las 4 cepas de L. paracasei, una fue L. casei subsp. rhamnosus, dos L. casei subsp. casei y otra no pudo ser identificada.

Resultados semejantes a los descritos en este trabajo han sido reportados anteriormente. Yeung y col. (16) tuvieron un 80% de coincidencia entre el método de fermentación de carbohidratos (API) y el método molecular (análisis de la secuencia de la subunidad 16S del DNA ribosomal) al identificar cepas de L. rhamnosus; en cambio, algunas cepas identificadas como L. acidophilus por API fueron identificadas molecularmente como L. delbrucki y L. crispatus, y en un caso una de las cepas fue identificada como Streptococcus sanguis. Sin embargo, dentro del mismo estudio se encontraron algunas coincidencias, todas las cepas identificadas en las etiquetas como L. casei fueron identificadas como L. paracasei tanto por métodos fenotípicos como genotípicos.  En un estudio realizado por Annuk y col. (17), un tercio de los lactobacilos identificados difirieron al ser identificados por API y PCR. En el caso del grupo de lactobacilos homofermentativos obligados, la técnica molecular reasignó cinco de nueve cepas, cabe señalar que en dicho estudio, 2 de 5 cepas (40%) de L. acidophilus no pudieron ser confirmadas por el método molecular y una cepa de L. rhamnosus fue identificada como L. paracasei.

Boyd y cols. (18) encontraron que mas de la mitad de los lactobacilos analizados (L. jensenii y L. gasseri) habían sido identificados erróneamente como L. acidophilus utilizando el  API 50 CH al identificar dichas cepas utilizando sondas de DNA. Se encontró que hay un alto nivel de variabilidad fenotípica entre especies probióticas de lactobacilos y que sugiere, en combinación con una limitada base de datos para la identificación de estas especies el uso limitado de este método y de otros métodos fenotípicos de identificación.

Como se puede observar, las diferencias en la identificación por los métodos moleculares y bioquímicos encontradas en este trabajo fueron también reportadas por otros investigadores. Al igual que esos autores, se sugiere que las diferencias se deben a que la base de datos del método API no está actualizada con respecto a la taxonomía más reciente lo que conducirá a una errónea identificación o a resultados confusos (19, 20).

No cabe duda que la taxonomía de las bacterias ácido lácticas ha evolucionado en los últimos 15 años. De agrupar a los integrantes por las características fenotípicas tales como fermentación de carbohidratos, tinción de gram y morfología, se ha pasado a agruparse de acuerdo a características genotípicas como la secuencia de la subunidad del 16S del DNA ribosomal (21, 22). Lo anterior trajo como consecuencia que algunas cepas que estaban agrupadas en una especie mediante el método fenotípico ahora estén formando parte de otras especies según los métodos genéticos.

La investigación realizada durante este trabajo puede contribuir al control de calidad microbiano de productos probióticos comerciales, un aspecto de los probióticos que se ha descuidado a menudo en el pasado. En vista del aumento significativo del consumo de alimentos probióticos, es de gran importancia que estos productos estén etiquetados correctamente e indiquen con claridad el tipo de microorganismos que contienen, ya sean probióticos o no probióticos y que los microorganismos utilizados estén bien documentados con respecto a seguridad, funcionalidad y el tipo de beneficio a la salud que promueve.

Resumen

Los probióticos son microorganismos utilizados en los alimentos probióticos que ejercen efectos positivos para la salud. Tradicionalmente, la identificación de estos microorganismos es por  métodos bioquímicos clásicos, no obstante, estos métodos son laboriosos y la identificación no es al nivel de subespecie, por lo anterior, actualmente métodos moleculares han sido utilizados para este propósito. El objetivo de este trabajo fue identificar mediante la técnica de Reacción en Cadena de la Polimerasa (PCR) cepas de microorganismos probióticos del género Lactobacillus aisladas de alimentos y suplementos, previamente identificadas por métodos bioquímicos. De 12 cepas analizadas, solamente se pudieron identificar 11 (91.6%) por PCR ya que una (8.3%) de ellas no pudo ser identificada con los juegos de iniciadores probados. Siete cepas (58.3%) coincidieron en la identificación por ambos métodos; 2 de ellas pertenecen a L. casei subsp. rhamnosus y 5 a L. acidophilus. Una cepa previamente identificada como L. acidophilus se identificó por PCR como L. casei subsp. casei. De las 4 cepas que por API se identificaron como L. paracasei, una fue L. casei subsp. rhamnosus, dos L. casei subsp. casei y otra no pudo ser identificada por PCR. Los resultados muestran que hay discrepancias entre la identificación molecular y la bioquímica de las especies de lactobacilos analizadas. Esto pone de manifiesto la necesidad de utilizar técnicas específicas que permitan una buena identificación de estos microorganismos para asegurar el aprovechamiento adecuado de los efectos benéficos de los probióticos.

Palabras clave: probióticos, identificación molecular, lactobacilos, alimentos funcionales

Abstract

Probiotic microorganisms are used in probiotic food that exert positive health effects. Traditionally, the identification of these microorganisms is by classical biochemistry methods, notwithstanding, these methods are time consuming and the identification is not to subspecies level, hence, recently molecular methods are been used for this propose. The goal of this work was the identification by Polimerase Chain Reaction (PCR) of probiotic microorganism’s strains from genus Lactobacillus isolates from food and supplements and that were previously identify by biochemical methods. From 12 strains analyzed, only 11 (91.6%) were identified by PCR, the other one (8.3%) could not be identified with the used primers. Seven strains (58.3%) agreed on the identification by both methods; 2 of them belong to L. casei subsp. rhamnosus and 5 to L. acidophilus. One strain previously identified as L. acidophilus was identified by PCR as L. casei subsp. c casei. Of the 4 strains that were identified by API as L. paracasei, one was L. casei subsp. rhamnosus, two L. casei subsp. casei and another could not be identified by PCR. The results show that there were discrepancies between the biochemistry and molecular identification of species of Lactobacillus analyzed. This highlights the need to use specific techniques that allow a good identification of these microorganisms to ensure the appropriate use of the beneficial effects of probiotics.

Keywords: probiotic, identification molecular, lactobacillus, functional foods

Referencias

1. Alvídrez-Morales, AA, BE González-Martínez y Z Jiménez-Salas 2002. Tendencias en la producción de alimentos: Alimentos funcionales. Revista Salud Pública y Nutrición. 3 (3). http://www.respyn.uanl.mx/iii/3/ensayos/alimentos_funcionales.html

2. Gibson GR and MB Roberfroid. 1995. Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. Journal of Nutrition 125 (11): 1401-1412.

3. González-Martínez BE, M Gómez-Treviño y Z Jiménez-Salas. (2003). Bacteriocinas de probióticos. Revista Salud Pública y Nutrición. 4 (2). http://www.respyn.uanl.mx/iv/2/ensayos/bacteriocinas.htm

4. Torres-Vitela, R. 2002. Flora Intestinal, probióticos y salud. Editorial Formas Finas 2ª ed. 22-88.

5. Pardio Sedas VT, KN Waliszwski Kubiak y G. Robledo López 1994. Los probióticos y su futuro. Archivos Latinoamericanos de Nutrición. 46 (1): 6-10.

6. Rodríguez-Vargas F, BR De León-Rodríguez, L Reyes-Escogido y AP. Barba de la Rosa 2003. Detección por PCR de probióticos en productos lácteos fermentados. 6º Congreso Internacional: Inocuidad de Alimentos. XXI Reunión Nacional de Microbiología de los Alimentos. Guadalajara, Jal. México.

7. Food and Agriculture Organization of the United Nation’s and World Health Organization. 2002. Report of a Joint FAO/WHO Working group on drafting. Guidelines for the Evaluation of Probiotics in Food. ftp://ftp.fao.org/es/esn/food/wgreport2.pdf.

8. Theunissen J, TJ Britz, RC T orriani and RC.Witthuhun 2005. Identification of probiotic microorganisms in South African products using PCR-based DGGE analysis. Int. J. Food Microbiology. 98: 11-21

9. González-Martínez BE. 2005. Queso fresco como vehículo para microorganismos probióticos y su efecto sobre el crecimiento de Salmonella enteritidis var. Typhimurium, Compendio de Tesis Doctoral, Facultad de Ciencias Biológicas, Universidad Autónoma de Nuevo León, México.

10. Rodríguez-Vargas F. 2002. Uso de probióticos en la elaboración del yogurt. Tesis de Maestría. Instituto Tecnológico de Celaya.

11. González-Martínez, BE. Op cit.

12.- Sanders ME. 2000. Considerations for use of probiotic bacteria to modulate human health. J. Nutr. 130 Suppl. : 384S – 390S.

13. Ouwehand AC, S Salminen and E. Isolauri  2002. Probiotics: an overview of benefical effects. Antonie Van Leeuwenhoek. 82: 279-289.

14. Salminen S, A Von Wright, L Morell, P Marteau, D Brassart, WM De Vos, R Fonden, M Saxelin, K Collins, G Mogensen, SE Birkeland and T Mattila-Sandholm. (1998). Demonstration of safety of probiotics – a Review. International Journal of Food Microbiology 44 (5): 93-106.

15. Vanderhoff JA, and R Young. (2002). Probiotics in pediatrics, Pediatrics 109 (5): 956-958.

16. Yeung S, M Sanders, ME Kitts, CLR Cano and PS Tong. 2003. Species-specific identification of commercial probiotic strains. International Journal of Dairy Science. 85 (3): 1039–1051.

17. Annuk H, J Shchepetova, T Kullisaar, E Songisepp, M Zilmer and M Mikelsaar. 2003. Characterization of intestinal lactobacilli as putative probiotic candidates. Journal of Applied Microbiology 94 (3): 403–412.

18. Boyd M, M Antonio and S Hillier. 2005. Comparison of API 50 CH strips to whole-chromosomal DNA probes for identification of Lactobacillus species. Journal of Clinical Microbiology, 43 (10): 5309-5311.

19. Nigatu A. 2000. Evaluation of numerical analyses of RAPD and API 50 CH patterns to differentiate Lactobacillus plantarum, Lactobacillus fermentum, Lactobacillus rhamnosus, Lactobacillus sake, Lact. parabuchneri, Lactobacillus gallinarum, Lactobacillus casei, Weissela minor and related taxa isolated from kocho and tef. Journal of Applied Microbiology  89 (6):969–978.

20. Boyd M, et al., Op. cit.

21. Janssen P, R Coopman, G Huys, J Swings, M Bleeker, P Vos, M Zabeau and K Kersters. 1996. Evalutation of the DNA fingerprinting method AFLP as a new tool in bacterial taxonomy. Journal of Microbiology 142 (7): 1881-1893.

22. Ben Amor K, EE Vaughan and WM de Vos. 2007. Advanced Molecular Tools for the Identification of Lactic Acid Bacteria. J. Nutr. Suppl.: 741S-747S.


Revista de la Facultad de Salud Pública y Nutrición
Ave. Dr. Eduardo Aguirrre Pequeño y Yuriria
Col Mitras Centro, Monterrey, N.L. México 64460
Tels. (8)348-4354, 348-6080, 348-6447
respyn@faspyn.uanl.mx

Universidad Autónoma de Nuevo León
webmaster@uanl.mx